Shaquille Lane 11140 Cedar Glen Vw Colorado Springs Co

Shaquille Lane11140 Cedar Glen Vw Colorado Springs Co 80921302 670

Shaquille Lane11140 Cedar Glen Vw Colorado Springs Co 80921302 670

Shaquille Lane 11140 Cedar Glen Vw, Colorado Springs, CO • [email protected]

Mission Determined and accomplished U.S Marine Sergeant with 7+ years of leadership and management experience ready to transfer skills and support to the private sector. Highly devoted individual with an efficient 10+ years of personal self-taught Informational Technology (IT) knowledge and 3+ years of professional assistance. Ready to integrate diversity, teach, learn and collaborate within a valued team.

Skills · Expert Time Manager · Personal and Public Speaking · Critical Thinking and Problem-Solving abilities · Operational Stress Control Advocate · Strong Interpersonal Communication skills · Experienced Computer Hardware Replacement · System Networking Capabilities · Python Programming Experience · Oracle Data Management (GCSS-MC) · Microsoft Operating System Repair

CERTIFICATION · · Active Secret Security Clearance (Security Letter Provided) · 29 CFR OSHA (30hr) Certificate · CompTIA Security+ (IN PROGRESS TO COMPLETE)

Education · National University Associates of Computer Science JAN 2019- MAY 2021

Work History United States Marine Corps September 2014 - Present

Contract Profession: Automotive Organizational Technician

Current Position: Sr. Ground Quality Assurance Specialist May 2018- PRESENT

Additional Positions: Personnel Advisor / Manager / Safety Supervisor Locations: San Diego, CA | Yuma, AZ | Bahrain | Kuwait | Guam · Maintained maintenance and analyzed data on over 450+ service request within Global Combat Support System (GCSS) · Assured the success and quality of all mechanical and electrical components on 120+ Tactical gear · Repaired military grade tracking devices and other SATCOM computers · Analyzes, reported, and managed all Global Combat Support Systems Marine Corps, Maintenance Production Report (MPR) and MDSS II data to ensure that equipment is properly maintained and recorded · Determined the Force Activity (FAD) and Urgency of Need (UND) Designator to better supply the military’s mission · Prioritized workload and motivated a team to perform in demanding conditions to meet deadlines · Assisted in planning training and operational activities to overlook a productive work environment · Tested, troubleshoot, and evaluated existing local area networks (LAN) on 50+ computer systems · Integrated a local shared files hub to provide direct support to management and subordinates within the work area · Expedited various backup procedures to mitigate the loss of sensitive information · Controlled the security of second-level Secret Internet Protocol Router Network (SIPRNet) sensitive information · Previous Position: Assistant Data Systems Administrator / Chief Tactical Ground Technician MAY 2015-May 2018 Locations: Okinawa, Japan | Seoul, Korea | Sattahip, Thailand · Supported the management of computers and Network Operating Systems (NOS) while enabling command and control · Installed, repaired, and/or replaced over 75 desktop, laptop PCs, servers and tactical equipment · Upheld a digital inventory of installed software and software licensing · Coordinated with Supply representatives consistently to guarantee that all service request is managed appropriately · Followed Supply Management Unit (SMU) and Repairable Issue Point (RIP) protocols to acquire special components · Troubleshoot and repaired hardware and network connectivity issues throughout the workplace · Performed over 35 image/reimage Windows Laptops and Desktops using government provided images · Troubleshoot printer device issues (paper loading, connectivity, updates etc.) · Utilized standard commercial word processing, database, spreadsheet, and statistical software applications · Planned and supervised preventative and corrective maintenance of vehicles and equipment · Mastered advanced skills such as teamwork, discipline, training, and communication

Paper For Above instruction

Understanding the process of gene transcription and translation is fundamental to grasping how genetic information encoded in DNA leads to the synthesis of proteins, which perform a vast array of functions vital for life. The provided DNA sequence, which includes part of a prokaryotic promoter and gene, serves as a practical example to illustrate this complex biological process, encompassing transcription, mRNA translation, and potential mutations affecting protein synthesis.

The initial step is to identify the template strand of DNA and its start site. In the given sequence, the starting point of transcription (+1 site) is marked by a box, typically representing where RNA polymerase initiates transcription. The sequence provided is:

ATAGAACGATTTAATACCTGGAATGCC

GGAGCCTAGGGCTAC

It’s essential to determine which strand functions as the template. Usually, the template strand is complementary to the mRNA produced. To transcribe, one reads the template strand in the 3' to 5' direction, synthesizing mRNA in the 5' to 3' direction, complementary to the template. For simplicity, assuming the given sequence is coding (sense) and the template is its complement, the mRNA sequence is derived by complementary base pairing: adenine (A) pairs with uracil (U) in RNA, thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).

Transcribing the DNA sequence into mRNA, we obtain the sequence:

5'-UAUCUUGCUAAAUUAUGGACC AA UACGG-3'

In this sequence, the transcription starts at the +1 site, and ends where the sequence concludes. The mRNA is labeled with a 5' and 3' end, reflecting its polarity, which is essential for subsequent translation.

Identifying the start codon, typically AUG, signals where translation begins. In the mRNA sequence, the first AUG codon appears in proximity to the start site, marking the initiation point for translation. The genetic code then guides the translation of codons into amino acids, forming the primary structure of the protein.

The translation proceeds until a stop codon (UAA, UAG, or UGA) is encountered, signaling the end of translation. The resultant amino acid sequence comprises the N-terminus (start) and C-terminus (end). The actual protein sequence can be deduced by translating each codon starting with the initiation codon, using the genetic code table.

If mutations occur—such as a C-G base pair changed to an A-T pair, or a deletion of a C-G pair—they can significantly affect the resulting protein. For instance, replacing a cytosine with adenine in the codon may lead to an amino acid substitution, potentially altering protein function or resulting in a nonfunctional protein.

In conclusion, understanding transcription and translation through the analysis of this sequence demonstrates the intricate relationship between DNA sequences, mRNA synthesis, and protein formation. Mutational impacts further emphasize the delicate balance within genetic coding, highlighting the importance of sequence integrity for proper cellular function.

References

  • Alberts, B., Johnson, A., Lewis, J., Morgan, D., Raff, M., Roberts, K., & Walter, P. (2014). Molecular Biology of the Cell (6th ed.). Garland Science.
  • Brown, T. A. (2016). Genetics: A Conceptual Approach (3rd ed.). Pearson Education.
  • Lehninger, A. L., Nelson, D. L., & Cox, M. M. (2017). Lehninger Principles of Biochemistry (7th ed.). W.H. Freeman.
  • Madigan, M. T., Bender, K. S., Buckley, D. H., Sattley, W. M., & Stahl, D. A. (2018). Brock Biology of Microorganisms (15th ed.). Pearson.
  • Nelson, D. L., & Cox, M. M. (2017). Principles of Biochemistry (7th ed.). W.H. Freeman.
  • Watson, J. D., Baker, T. A., Bell, S. P., Gann, A., Levine, M., & Losick, R. (2014). Molecular Biology of the Gene (7th ed.). Pearson.
  • Richardson, J. M., & Nelson, D. (2018). Basic Genetics. OpenStax.
  • Robert, K. (2019). Genetic Mutations and Their Effects. Journal of Biochemistry, 45(3), 245-259.
  • Smith, J. A. (2020). Impacts of Point Mutations on Protein Function. Molecular Genetics, 58(2), 112-125.
  • Berg, J. M., Tymoczko, J. L., Gatto, G. J., & Stryer, L. (2015). Biochemistry (8th ed.). W.H. Freeman.

Related Assignments